• Users Online: 190
  • Print this page
  • Email this page


 
 
Table of Contents
ORIGINAL ARTICLE
Year : 2019  |  Volume : 5  |  Issue : 1  |  Page : 42-49

Effects of ginsenoside Rb1 on skeletal muscle insulin resistance and adenosine monophosphate-activated protein kinase signaling pathway in obese mice


1 School of Chinese Medicine, Beijing University of Chinese Medicine, Beijing, China
2 Department of Endocrinology, South Area of Guang'anmen Hospital, China Academy of Chinese Medical Sciences, Beijing, China
3 Leonard Davis School of Gerontology, University of Southern California, Los Angeles, CA, USA

Date of Submission06-Nov-2018
Date of Acceptance11-Jan-2019
Date of Web Publication7-Mar-2019

Correspondence Address:
Si-Hua Gao
School of Chinese Medicine, Beijing University of Chinese Medicine, Beijing 100029
China
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/wjtcm.wjtcm_3_19

Rights and Permissions
  Abstract 


Objectives: The objective of the study is to observe the effects of ginsenoside Rb1 on indexes of body weight, body composition, blood lipid, skeletal muscle endurance, and insulin sensitivity in obese mice, probe into its pharmacological action, and further explore its effects on adenosine monophosphate-activated protein kinase (AMPK) signaling pathway in skeletal muscle. Materials and Methods: Eight-week-old C57BL/6J mice were fed with high-fat diet for 12 weeks to establish obese mouse model. The model-establishment obese mice were randomly divided into three groups including model control group, metformin group, and ginsenoside Rb1 group. In the normal control group, normal diet was administered. The intervention period was 8 weeks. Body weight and food intake of the mice were measured regularly every week. The treadmill test was performed at weeks 3 and 7, and the oral glucose tolerance test was carried out at weeks 4 and 8. Body composition of the mice was detected by applying NMR Animal Body Composition Analyzer at week 8. Four parameters of blood lipids and free fatty acid (FFA) levels were detected. The mRNA expression of AMPKα and proliferator-activated receptor gamma coactivator-1α (PGC-1α) in skeletal muscle was examined by real-time fluorescence quantitative polymerase chain reaction, and the influence of ginsenoside Rb1 on protein expression of AMPKα, p-AMPKα, and PGC-1α was observed by western blotting. Results: The body weight (since the 5th week of drug administration) and food intake of the mice in the ginsenoside Rb1 group were significantly lower than those in the model control group (P < 0.05) in a time-dependent manner. Ginsenoside Rb1 could significantly reduce the levels of triglyceride and low-density lipoprotein cholesterol, while increase the high-density lipoprotein cholesterol level (P < 0.05). In addition, ginsenoside Rb1 could reduce the serum FFA level (P < 0.05). After the administration of ginsenoside Rb1 for 8 weeks, the body fat mass of obese mice decreased and the lean mass increased (P < 0.05). The skeletal muscle endurance and the oral glucose tolerance of the obese mice improved using ginsenoside Rb1. At the molecular level, ginsenoside Rb1 could up-regulate the mRNA and protein expression of AMPKα in skeletal muscle, and increase the content of p-AMPK protein significantly (P < 0.01). At the same time, the mRNA and protein level of PGC-1α was also un-regulated, correspondingly (P < 0.01). Conclusion: Ginsenoside Rb1 exerts effects on reducing body weight, decreasing blood lipid levels, enhancing the skeletal muscle endurance, and increasing the insulin sensitivity in obese mice by activating the related proteins in AMPK signaling pathway in skeletal muscle.

Keywords: Adenosine monophosphate-activated protein kinase signaling pathway, ginsenoside Rb1, insulin resistance, obesity, skeletal muscle


How to cite this article:
Zhao DD, Bai Y, Wu R, Mo FF, Liu CY, Zhu RY, Jiang GJ, Liu JX, Zhang DW, Gao SH. Effects of ginsenoside Rb1 on skeletal muscle insulin resistance and adenosine monophosphate-activated protein kinase signaling pathway in obese mice. World J Tradit Chin Med 2019;5:42-9

How to cite this URL:
Zhao DD, Bai Y, Wu R, Mo FF, Liu CY, Zhu RY, Jiang GJ, Liu JX, Zhang DW, Gao SH. Effects of ginsenoside Rb1 on skeletal muscle insulin resistance and adenosine monophosphate-activated protein kinase signaling pathway in obese mice. World J Tradit Chin Med [serial online] 2019 [cited 2019 May 23];5:42-9. Available from: http://www.wjtcm.net/text.asp?2019/5/1/42/253497




  Introduction Top


Insulin resistance (IR) refers to a decrease in the ability of insulin to maintain normal blood sugar with its biological effect inferior to normal, or a decrease in the reactivity of surrounding target tissues such as liver, muscle, and adipose tissue to insulin leading to a decrease of glucose intake and utilization efficiency giving rise to a series of clinical manifestations. IR is one of the important pathogenesis of type 2 diabetes mellitus (T2DM). Studies have shown that 80% of T2DM patients accompanying with obesity. The pathological changes are characterized by disorder of lipid metabolism due to obesity leading to IR.[1] Skeletal muscle is the main target of insulin action, and responsible for more than 80% of glucose metabolism after meal.[2] Adenosine monophosphate-activated protein kinase (AMPK) is the main kinase regulating metabolism of skeletal muscle cells and gets involved in multiple metabolic pathways such as regulation of glucose consumption.[3] AMPK, a metabolic sensor, gatekeepers of the activity of the master regulator of mitochondria, proliferator-activated receptor gamma coactivator-1α (PGC1α), are vital links in a regulatory network for metabolic homeostasis. It was accepted that the development of metabolic disorders such as obesity and type 2 diabetes-related closely to the improper function of the energy regulating network, including PGC-1α and AMPK.[4] Moreover, researchers find that the caloric restriction leads to phospho-activation of AMPK in muscle and increase expression of PGC-1 in skeletal muscle, and vice versa.[5]

Ginsenoside Rb1 is one of the representative components of ginsengdiol saponins. It is mainly distributed in traditional Chinese herbal medicines such as Radix et Rhizoma Ginseng (rén shēn), Radix et Rhizoma Notoginseng (sēn qī), and Radix Panacis Quinquefolii (xī yáng shēn), which is widely used to treat DM, coronary heart disease, and tumor. Studies have shown that ginsenoside Rb1 exhibits a variety of pharmacological actions such as central nervous system, cardiovascular system, immune system, and anti-tumor,[6] but few reports on lowering blood glucose and regulating IR, especially in skeletal muscle energy regulation using ginsenoside Rb1. Therefore, we would like to observe the effects of ginsenoside Rb1 on body composition, blood lipids, glucose tolerance, and AMPK signaling pathway in obese mice, and to provide a scientific basis for further elucidation of ginseng for DM and its complications.


  Materials and Methods Top


Materials

Animal and fodder

Eight-week-old male C57BL/6J mice were purchased from Beijing Sibefu Biotechnology Co., Ltd. (license No. SCXK [Beijing] 2014-0004) and were raised in the Animal Laboratory with Barriers of Beijing University of Chinese Medicine. The mice were housed in single cages, in a 12-h light/dark cycle, at a constant 23°C with 45% relative humidity. The mice were free to water during feeding. As ordinary feed, AIN-96G full-price nutrient feed was used, and high-fat purified feed was provided by Jiangsu Medison Biomedical Co., Ltd. (Yangzhou, China).

Drugs

Ginsenoside Rb1 was purchased from Chengdu Puruifa Technology Development Co., Ltd (Chengdu, China). Metformin hydrochloride tablet was from Sino-America Shanghai Squibb Pharmaceutical Co., Ltd. (Shanghai, China). They all stored at 4°C. Prepare the suspension of the desired concentration with ultrapure water before gavage.

Reagents and equipment

The blood lipid kits were all products of Nanjing Jiancheng Bioengineering Research Institute (Nanjing, China). Free fatty acid (FFA) kits were provided by Beijing Bainuo Co., Ltd (Beijing, China). The automatic biochemical analyzer was Hitachi 7080 (Tokyo, Japan). The NMR Animal Body Composition Analyzer was from Shanghai Newmai Electronic Technology Co., Ltd (Shanghai, China). AMPK, p-AMPK, PGC-1α, and GAPDH primary antibody were all purchased from CST (Cell Signaling Technology, Danvers, MA). Horseradish peroxidase-labeled secondary antibody was from Zsbio, Co., Ltd (Beijing, China).

Methods

Model establishment, grouping, and drug administration

Fifty male C57/B6J mice (8-week-old) were randomly selected 10 ones as the normal control group after 1-week adaptive feeding. The remaining 40 mice were fed with a high-fat diet for 12 weeks, and the body weight was 20% greater than the average weight of the normal control group as a model for obese mice. Successful establishment of model obese mice was randomly divided into model control group, metformin group and ginsenoside Rb1 group, with eight mice in each group.

Drug administration

Continuous intragastric administration for 8 weeks, 20 mg/kg/day ginsenoside Rb1 was used in the ginsenoside Rb1 group, and the dosage was determined according to the previous document;[7] in the metformin group, 75 mg/kg/day with the volume of 0.1 mL–10 g body weight; in the normal control and model control groups, the sterile water with the same volume was used for gastric lavage.

Detected indicators and methods

Body composition detection

At the 8th week of drug intervention, the body composition of mice in each group was tested by NMR Animal Body Composition Analyzer, and the body fat content and body muscle content were recorded.

Oral glucose tolerance test

Oral glucose tolerance test (OGTT) was performed at weeks 4 and 8 after drug intervention. Before the experiment, the mice were fasted overnight, and 50% glucose was intraperitoneally injected at 2 g/kg body weight. The blood glucose of the mice before the injection (0 min) and 30 min, 60 min, and 120 min after the injection was measured. The OGTT time curve was plotted, and the curve was calculated by the approximate trapezoidal method. The area under the Curve (AUC) is calculated as follows: AUC = 0.5 × (BG 0 min + BG 30 min)/2 + 0.5 × (BG 30 min + BG 60 min)/2 + 1 × (BG 60 min + BG 120 min)/2.

Exhaustion time determination using treadmill test for mice

At weeks 3 and 7 of the gavage, mice in each group underwent 6-day treadmill adaptation training, and then, a formal test was performed to record the exhaustion time of each animal per day. The exhaustion speed was 20 m/min, and the running platform slope is 5°. The exhaustion standard included continuous drop into the power grid with shock, being always in the last third of the runway, resting in abdomen position, shortness of breath, and inability to finish the treadmill test. The exhaustion time was recorded.

Detection of blood lipids and free fatty acid levels

After 8 weeks of administration, fasting overnight, the animals were anesthetized the next morning. The blood was collected from the abdominal aorta, and the serum was separated after centrifugation. The levels of triglyceride (TG), total cholesterol (TC), and high-density lipoprotein cholesterol (HDL-C) and low-density lipoprotein cholesterol (LDL-C) were determined using the biochemical analyzer. The level of serum FFA was determined according to the kit instructions.

Collection of skeletal muscle tissue

After animal anesthesia, the hind limb skeletal muscles were exposed, and the gastrocnemius muscles were cut out as skeletal muscle collection. The skeletal muscles were washed with 4°C saline for subsequent electron microscopy (fresh tissue fixation) and molecular biological indicators detection (80°C freezing save).

Real-time fluorescence quantitative polymerase chain reaction

The total RNA was extracted from skeletal muscle tissue using the Trizol method. Following the reverse transcription kit instruction, total RNA was transcribed into single-stranded cDNA. Further, reaction system of SYBR MIX (10 μL) + cDNA template (2 μL) + upstream/downstream primers (1 μL each) + nuclease-free ultrapure water (6 μL) was subjected to amplification reaction on a real-time polymerase chain reaction instrument, pre-denaturation at 95°C for 2 min, followed by denaturation at 95°C for 20 s, annealing for 15 s, extension at 72°C for 30 s, and thus repeated 40 cycles. After that, it was stored at 4°C. Three replicate wells were set up for each sample. AMPK upstream primers were AAACCCACAGAAATCCAAACAC, downstream primers were CCTTCCATTCATAGTCCAACTG; PGC-1α upstream primers were CCCTGCCATTGTTAAGACC, and downstream primers were TGTTGCTGTTCCTGCTCCT.

Western blotting

After cutting the skeletal muscle tissue, pyrolysis in a lower temperature was carried on in the pre-cooled RIPA lysate containing 1% PMSF, centrifugation, and the total protein was extracted and determined according to the BCA kit. SDS-PAGE separation gel and concentration gel were prepared, after that, electrophoresis, transmembrane, blocking were performed. The PVDF membrane was incubated with diluted AMPK, p-AMPK, PGC-1α (1:1000, 5% skim milk powder diluted), shaking at 4°C overnight, and then incubated for 1.5 h using fluorescent secondary antibody (dilution in 1: 5000) at room temperature. The color development was by ECL luminescence, and imaging was exposed by gel imager. ImageJ software analyzed the gray scale of the strip and performed the semi-quantitative analysis.

Statistical analyses

Statistical analysis was performed using SPSS17.0 software. The measurement data were expressed as mean ± standard error of the mean. The data of multiple groups were compared using analysis of variance. The comparison between the two groups was performed by Dunnett or independent sample t-test. P < 0.05 was considered as statistical significance. GraphPad Prism6 software was used for data management and charting (GraphPad Software Inc., San Diego, Calif, USA).


  Results Top


Effects on body weight and food intake in obese mice

As shown in [Figure 1]a, after ginsenoside Rb1 intervention, the difference in body weight between the ginsenoside Rb1 group and the model control group on week 5 after drug administration was statistically significant (P < 0.05), which was similar to the positive drug metformin. As shown in [Figure 1]b, the body weight of the model control group increased by 9.50 g at average, significantly higher than that of the normal control group, 1.40 g (P < 0.05). The mice in the metformin group lost weight by 0.63 g, while in the ginsenoside Rb1 group, the body weight of mice increased by 1.04 g, which were displayed statistical differences between the metformin group and the model control group, and between the ginsenoside Rb1 and the model control group (P < 0.05). As shown in [Figure 1]c, the food intake of mice in the model control group was significantly higher than that of the normal control group (P < 0.05). Compared with the model control group, the food intake of the metformin group (from the 6th week) and the ginsenoside Rb1 group (from the 1st week) differed significantly (P < 0.05).
Figure 1: Comparison of the body weight (a), body weight gain (b) and food intake (c). *versus normal control group, P < 0.05, #versus model control group, P < 0.05. NC: Normal control; MC: Model control

Click here to view


Effects on the fat content and the content of muscle tissues

As shown in [Figure 2]a and [Figure 2]b, the content of muscle tissue in mice fed with high-fat diet was significantly lower than that in the normal control group, and the body fat content was significantly higher compared with that in the normal control group (P < 0.05). After 8-week drug intervention, the body fat content in the metformin and ginsenoside Rb1 groups was 19.50% and 20.91%, respectively, which decreased significantly compared with that of the model control group, 30.46% (P < 0.05). The body muscle content was 72.64% and 72.61%, respectively in the metformin and ginsenoside Rb1 groups, significantly higher than that of the model control group, 60.02%, suggesting that ginsenoside Rb1 can reduce the total amount of fat in obese mice, increase the muscle tissue content, and have a certain effect on improving body composition.
Figure 2: Comparison of the lean mass (a) and the fat mass (b). *versus normal control group, P < 0.05, #versus model control group, P < 0.05. NC: Normal control; MC: Model control

Click here to view


Regulate blood lipid levels and free fatty acid levels in obese mice

As shown in [Figure 3]a, [Figure 3]b, [Figure 3]c, [Figure 3]d, the blood lipid levels of the model control group were abnormal. Specifically, the levels of TC, TG, LDL-C elevated, while the level of HDL-C was in decrease. Compared with the normal control group, the differences were significant (P < 0.05). Eight weeks after drug intervention, ginsenoside Rb1 could significantly reduce TG, LDL-C levels, and increase serum HDL-C level, compared with the model control group, the differences were significant (P < 0.05). As shown in [Figure 3]e, compared with the normal control group, the FFA level of the model control group increased significantly (P < 0.05). After 8 weeks of drug intervention, both metformin and ginsenoside Rb1 could significantly reduce the FFA level of obese mice. Compared with the model control group, the difference in FFA level was displayed statistical significance (P < 0.05).
Figure 3: Comparison of the serum triglyceride (a), total cholesterol (b), low density lipoprotein cholesterol (c), high density lipoprotein cholesterol (d) and free fatty acid (e). *versus normal control group, P < 0.05, #versus model control group, P < 0.05. NC: Normal control; MC: Model control

Click here to view


Improve insulin sensitivity in obese mice

As shown in [Figure 4], the blood glucose at various points-in-time and the AUC in the model control group were significantly higher than those of the normal control group (P < 0.05), suggesting that the obese mice suffered from impaired glucose tolerance in this experiment. At 4 weeks after administration, the blood glucose level in mice at 30 min and 60 min markedly decreased in the metformin group, and the AUC was also greatly less than that of the model control group. However, for the ginsenoside Rb1, the OGTT at different points-in-time and the AUC in obese mice were not significant from those in the model control group (P > 0.05). At the 8th week of administration, ginsenoside Rb1 significantly decreased the blood glucose level after glucose load in mice and reduced the area under the glucose tolerance test (GTT) curve (P < 0.05). The effect of improving GTT in obese mice was equivalent to that of metformin, indicating that ginsenoside Rb1 can improve the glucose tolerance of obese mice, and this effect shows a certain time-effect manner.
Figure 4: Comparison of glucose (a) and the area under the curve (b) during oral glucose tolerance test at the fourth week; comparison of blood glucose (c) and the area under the curve (d) during oral glucose tolerance test at the eighth week. *versus normal control group, P < 0.05, #versus model control group, P < 0.05. NC: Normal control; MC: Model control

Click here to view


Enhance mice exercise tolerance

As shown in [Figure 5], in the model control group, the exhaustion time of the mice significantly decreased on weeks 3 and 7 compared with that in the normal control group (P < 0.05). Compared with the model control group, the exhaustive time of mice in the metformin and ginsenoside Rb1 groups was significantly prolonged (P < 0.05), indicating that ginsenoside Rb1 can markedly improve the skeletal muscle exercise tolerance in obese mice.
Figure 5: Comparison of the exhausting time during the treadmill test at the fourth week (a) and the eighth week (d). *versus normal control group, P < 0.05, #versus model control group, P < 0.05. NC: Normal control; MC: Model control

Click here to view


Influence on gene expression of skeletal muscle adenosine monophosphate-activated protein kinase α and proliferator-activated receptor gamma coactivator-1α in mice

As shown in [Figure 6], taking the untreated normal control sample as a reference, the expression of AMPKα and PGC-1α in skeletal muscle of obese mice was down-regulated. Compared with the model control group, the expression of AMPKα and PGC-1α mRNA in mice skeletal muscle in both the metformin and the ginsenoside Rb1 groups was significantly upregulated (P < 0.05).
Figure 6: Ginsenoside Rb1 on gene expression of adenosine monophosphate-activated protein kinase α and proliferator-activated receptor gamma coactivator-1α in skeletal muscle in obese mice. *versus normal control group, P < 0.05, #versus model control group, P < 0.05. NC: Normal control; MC: Model control

Click here to view


Influence on protein expression of skeletal muscle adenosine monophosphate-activated protein kinase α, p-adenosine monophosphate-activated protein kinase α and proliferator-activated receptor gamma coactivator-1α in mice

As shown in [Figure 7], compared with the normal control group, the expression of AMPKα, p-AMPKα, and PGC-1α proteins in the mice skeletal muscle of the model control group significantly decreased (P < 0.05). Compared with the model control group, in both the metformin and ginsenoside Rb1 groups, the expression of AMPKα, p-AMPKα, and PGC-1α proteins in skeletal muscle of mice significantly increased (P < 0.05).
Figure 7: Ginsenoside Rb1 on expression of adenosine monophosphate-activated protein kinase α, p-adenosine monophosphate-activated protein kinase α, and proliferator-activated receptor gamma coactivator-1α proteins in skeletal muscle in obese mice. *versus normal control group, P < 0.05, #versus model control group, P < 0.05. NC: Normal control; MC: Model control

Click here to view



  Discussion Top


IR is a condition in which the dose of insulin produced by our body is insufficient for the normal biological effect. From a quantitative point of view, skeletal muscle is the most important tissue for blood glucose utilization in the body and is the main target of peripheral IR. Solving the skeletal IR is of great significance on improving the metabolic state of individuals such as obesity and DM.[8] This study showed that after 12 weeks of a high-fat diet in mice, compared with normal-fed mice, obesity is obvious in morphology. In the physical constitutional analysis, the content of fat increased presented with marked IR, hyperlipidemia, and elevated level of serum FFA.

Ginsenoside Rb1 serves as one of the main active ingredients in ginseng, which gets involved in multiple links in the regulation of glucolipid metabolism on exploring the anti-diabetic mechanism of traditional Chinese herbal medicine ginseng.[9] In the current study, we found that ginsenoside Rb1 could markedly reduce the body weight, decrease the body fat content, regulate the disorder of dyslipidemia, and improve insulin sensitivity in obese mice, and its effect is equivalent to the positive drug metformin, which is in accord with the previous study.[10] On this basis, we also found that ginsenoside Rb1 could improve the body composition of obese mice, have a tendency of increasing muscle tissue content, and strengthen the skeletal muscle tolerance, indicating that ginsenoside Rb1 improves the IR status of obese mice. This effect is not only associated with up-regulation of adipocyte peroxisome proliferator-activated receptor gamma promoting adipocyte differentiation,[11] up-regulation of the expression of glucose transporters in adipocytes promoting glucose consumption,[10] inhibition of inflammatory responses and oxidative stress,[12] but also with the regulation of skeletal muscle energy substance metabolism.

The elevation of plasma FFA is a clinical feature of T2DM and obesity, and plays a decisive role in leading to IR.[13] Increased FFA levels in skeletal muscle cells due to elevated FFA levels in blood circulating can obviously reduce insulin-stimulated skeletal muscle glucose uptake and utilization, affect skeletal muscle energy metabolism, and trigger the skeletal muscle IR.[14],[15] In the current study, compared with the model control group, ginsenoside Rb1 can remarkably reduce the serum FFA levels, thereby further improving the metabolism of skeletal muscle energy substances.

Therefore, on the basis of pharmacodynamics, we further detected changes in AMPK and PGC-1α (peroxisome proliferator-activated receptor γ coactivator 1α), important regulators of skeletal muscle energy metabolism. Skeletal muscle is the main tissue of aerobic oxidation of glucose and lipids and plays an important role in regulating systemic energy metabolism. Copious studies displayed that AMPK is an energy receptor for skeletal muscle and can regulate the body's energy metabolism,[16] so some scholars believe that AMPK is a potential target in metabolic diseases and energy metabolism disorders.[17] As a key mediator of energy metabolism regulation, AMPK activation plays a vital role in the skeletal muscle energy metabolism through enhancing glucose uptake and oxidation of skeletal muscle cells, increasing the oxidation rate of fatty acids, and inhibiting muscle glycogen synthesis and promoting glycogen decomposition,[18] which is closely associated with skeletal muscle IR. Studies proved overexpression of AMPK in skeletal muscle tissue can increase fatty acid oxidation and prevent skeletal muscle lipid deposition induced by high-fat diet.[19] PGC-1α can regulate energy metabolism and induce mitochondrial biogenesis. Research exhibits that PGC-1α in skeletal muscle maintains glucose metabolism balance and establishes a cytokine-mediated association between skeletal muscle and islets.[20] AMPK, an important regulator of PGC-1α, activates PGC-1α, enhances skeletal muscle mitochondria and promotes fatty acid oxidation.[4] Therefore, activated AMPK can not only enhance glucose uptake by skeletal muscle cells through the increase of glucose transporter expression and transportation to its vesicle of the cell membrane,[21] but also improve the IR status by regulating PGC-1α which promotes mitochondrial oxidative respiratory chain activity.[22] In the present study, the expression of AMPK and PGC-1α genes in skeletal muscle tissue of model control mice was in a down-regulation tendency, and the tendency of PGC-1α activity changes was consistent with the activation trend of AMPK. After 8 weeks of ginsenoside Rb1 intervention, the two indicators were up-regulated remarkably. The results of protein levels were similar to the gene levels, and the expression of activated AMPK (p-AMPK) protein was significantly increased, indicating that ginsenoside Rb1 can activate the linkage reaction of AMPK-PGC-1α, affects the mitochondrial state and energy metabolism of skeletal muscle, thereby improving IR in an obese mouse model.

To sum up, ginsenoside Rb1 exerts remarkable effects on weight loss, lipid-lowering and improvement of skeletal muscle IR in obese mice. The mechanism may be related with FFA lowering, upregulation of skeletal muscle mitochondrial AMPK and PGC-1α gene expression, which activates AMPK, thereby enhancing mitochondrial function and fatty acid β oxidation, and ultimately reducing skeletal muscle lipid deposition. This study has laid a good foundation for the later research on ginsenoside Rb1 in the treatment of obesity, diabetes, and other metabolic diseases and the development of AMPK agonists.

Financial support and sponsorship

This work is supported by Natural Science Foundation of China (NSFC81503540&NSFC81274041), Chaoyang District Science and Technology Commission Collaborative Innovation Project (CYXC1513), Major New Drug Creation Sub-project (2012ZX09103201-005), Beijing Joint Construction Project (0101216-14&0101216-2013).

Conflicts of interest

There are no conflicts of interest.



 
  References Top

1.
Association AD. 7 Obesity management for the treatment of type 2 diabetes. Diabetes Care 2016;39 Suppl 1:S47.  Back to cited text no. 1
    
2.
Mu QQ, Zhao DD, Fang X, Yu N, Li XK, Zhang Y, et al. Exploration on the treatment of diabetes by regulating function of liver, spleen and kidney from the perspective of energy metabolism in skeletal muscles. China J Tradit Chin Med Pharm 2015;30:3860-3.  Back to cited text no. 2
    
3.
Wang L, Zhang P, Liu HJ, Xu SS, Chen XP. Expression changes of AMPK α and p-AMPK α in different fiber types of skeletal muscle during exercise. Chin J Appl Physiol 2013;29:4-5.  Back to cited text no. 3
    
4.
Cantó C, Auwerx J. PGC-1alpha, SIRT1 and AMPK, an energy sensing network that controls energy expenditure. Curr Opin Lipidol 2009;20:98.  Back to cited text no. 4
    
5.
Palacios OM, Carmona JJ, Michan S, Chen KY, Manabe Y, Ward JL, et al. Diet and exercise signals regulate SIRT3 and activate AMPK and PGC-1α in skeletal muscle. Aging 2009;1:771-83.  Back to cited text no. 5
    
6.
Jia JM, Wang ZQ, Wu LJ, Wu YL. Advance of pharmacological study on ginsenoside Rb_1. China J Chin Mater Med 2008;33:1371-7.  Back to cited text no. 6
    
7.
Yu X, Ye L, Zhang H, Zhao J, Wang G, Guo C, et al. Ginsenoside rb1 ameliorates liver fat accumulation by upregulating perilipin expression in adipose tissue of db/db obese mice. J Ginseng Res 2015;39:199-205.  Back to cited text no. 7
    
8.
Yin J, Zhang H. Summary of diabetic myopathy. Drug Eval 2012;9:35-41.  Back to cited text no. 8
    
9.
Luo JZ, Luo L. Ginseng on hyperglycemia: Effects and mechanisms. Evid Based Complement Alternat Med 2009;6:423-7.  Back to cited text no. 9
    
10.
Shang WB, Guo C, Zhao J, Yu XZ, Zhang H. Ginsenoside rb1 upregulates expressions of GLUTs to promote glucose consumption in adiopcytes. Zhongguo Zhong Yao Za Zhi 2014;39:4448-52.  Back to cited text no. 10
    
11.
Chan LS, Yue PY, Kok TW, Keung MH, Mak NK, Wong RN, et al. Ginsenoside-rb1 promotes adipogenesis through regulation of PPARγ and microRNA-27b. Horm Metab Res 2012;44:819-24.  Back to cited text no. 11
    
12.
Wang M, Chen Y, Xiong Z, Yu S, Zhou B, Ling Y, et al. Ginsenoside rb1 inhibits free fatty acidsinduced oxidative stress and inflammation in 3T3L1 adipocytes. Mol Med Rep 2017;16:9165-72.  Back to cited text no. 12
    
13.
Boden G. Free fatty acids (FFA), a link between obesity and insulin resistance. Front Biosci 1998;3:d169-75.  Back to cited text no. 13
    
14.
Boden G. Effects of free fatty acids (FFA) on glucose metabolism: Significance for insulin resistance and type 2 diabetes. Exp Clin Endocrinol Diabetes 2003;111:121-4.  Back to cited text no. 14
    
15.
Park SY, Kim MH, Ahn JH, Lee SJ, Lee JH, Eum WS, et al. The stimulatory effect of essential fatty acids on glucose uptake involves both akt and AMPK activation in C2C12 skeletal muscle cells. Korean J Physiol Pharmacol 2014;18:255-61.  Back to cited text no. 15
    
16.
Hardie DG, Sakamoto K. AMPK: A key sensor of fuel and energy status in skeletal muscle. Physiology (Bethesda) 2006;21:48-60.  Back to cited text no. 16
    
17.
Zhao DD, Mo FF, Mu QQ, Zhang Y, An H, Tian T, et al. Effects of Jiangtang Xiaoke Granule on AMPK signal pathway of muscular tissues of diabetic rats. Liaoning J Tradit Chin Med 2016;43:1525-7.  Back to cited text no. 17
    
18.
O'Neill HM, Holloway GP, Steinberg GR. AMPK regulation of fatty acid metabolism and mitochondrial biogenesis: Implications for obesity. Mol Cell Endocrinol 2013;366:135-51.  Back to cited text no. 18
    
19.
Barnes BR, Marklund S, Steiler TL, Walter M, Hjälm G, Amarger V, et al. The 5'-AMP-activated protein kinase gamma3 isoform has a key role in carbohydrate and lipid metabolism in glycolytic skeletal muscle. J Biol Chem 2004;279:38441-7.  Back to cited text no. 19
    
20.
Handschin C. The biology of PGC-1α and its therapeutic potential. Trends Pharmacol Sci 2009;30:322-9.  Back to cited text no. 20
    
21.
Viollet B, Lantier L, Devin-Leclerc J, Hebrard S, Amouyal C, Mounier R, et al. Targeting the AMPK pathway for the treatment of type 2 diabetes. Front Biosci (Landmark Ed) 2009;14:3380-400.  Back to cited text no. 21
    
22.
Kukidome D, Nishikawa T, Sonoda K, Imoto K, Fujisawa K, Yano M, et al. Activation of AMP-activated protein kinase reduces hyperglycemia-induced mitochondrial reactive oxygen species production and promotes mitochondrial biogenesis in human umbilical vein endothelial cells. Diabetes 2006;55:120-7.  Back to cited text no. 22
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5], [Figure 6], [Figure 7]



 

Top
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

 
  In this article
Abstract
Introduction
Materials and Me...
Results
Discussion
References
Article Figures

 Article Access Statistics
    Viewed243    
    Printed20    
    Emailed0    
    PDF Downloaded28    
    Comments [Add]    

Recommend this journal